plko 1 hygro vector Search Results


97
New England Biolabs vector plko 1 hygro for shrna
Vector Plko 1 Hygro For Shrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vector plko 1 hygro for shrna/product/New England Biolabs
Average 97 stars, based on 1 article reviews
vector plko 1 hygro for shrna - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

94
Addgene inc plko 1 hygro vector
Plko 1 Hygro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 hygro vector/product/Addgene inc
Average 94 stars, based on 1 article reviews
plko 1 hygro vector - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Millipore shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat
Shβcat; Plko.1 Hygro, Target Sequence Tctaacctcacttgcaataat, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat/product/Millipore
Average 90 stars, based on 1 article reviews
shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc plko.1 hygro
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko.1 Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1 hygro/product/Addgene inc
Average 90 stars, based on 1 article reviews
plko.1 hygro - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Addgene inc plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko 1 Hygro Shtraf3 Target Cctgcttccttggccgtttaa Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vectors
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vectors/product/Addgene inc
Average 96 stars, based on 1 article reviews
lentiviral vectors - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

98
Addgene inc plko 1 hygro
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko 1 Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 hygro/product/Addgene inc
Average 98 stars, based on 1 article reviews
plko 1 hygro - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

96
Addgene inc plko 1 plasmid
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 plasmid/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 plasmid - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
Addgene inc plko 1 vectors encoding shrnas
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko 1 Vectors Encoding Shrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 vectors encoding shrnas/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 vectors encoding shrnas - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
Addgene inc plko 1 neo vector control
Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) <t>pLKO.1</t> control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Plko 1 Neo Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 neo vector control/product/Addgene inc
Average 94 stars, based on 1 article reviews
plko 1 neo vector control - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

88
Addgene inc plko 1 shtgfbr3 puro
TGFBR3 and JUND are functionally important for 3D morphogenesis. ( a ) Time-dependent expression of TGFBR3 during 3D morphogenesis . ( b ) Knockdown of TGFBR3 and inducible addback of murine RNAi-resistant Tgfbr3. TGFBR3/Tgfbr3 levels for cells cultured in the absence (Lane 1 and 2) or presence (Lane 3) of 1 µg/ml DOX for 24 hours were analyzed by immunoblotting. Hsp90 was used as a loading control. Densitometry of TGFBR3/Tgfbr3 abundance is shown normalized to the shGFP control. ( c and d ) Blocking TGFBR3 induction specifically elicits a ductal-branching phenotype. The MCF10A-5E lines described in ( b ) were placed in morphogenesis in the absence (control and <t>shTGFBR3)</t> or presence (Tgfbr3 addback) of 1 µg/ml DOX from day 4–10. Acini were fixed at day 10 of 3D culture, stained for E-cadherin (green) and HA-tagged Tgfbr3 (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( e ) Constitutive expression of HA-tagged JUND analyzed by immunoblotting. Densitometry of JUND abundance is shown normalized to pBabe vector control. ( f and g ) Constitutive JUND expression causes stable cribiform-like acinar structures. Acini from the MCF10A-5E lines described in ( e ) were placed in morphogenesis, fixed at day 28, stained for E-cadherin (green) and HA-tagged JUND (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( h ) Homogenization of JUND expression by knockdown of JUND and addback with murine RNAi-resistant JunD to near-endogenous expression levels. JUND/JunD levels were determined by immunoblotting. Densitometry of JUND/JunD abundance is shown normalized to the shGFP control. ( i ) Quantification of the cribiform-like phenotype at day 28 of 3D culture for the cells in ( h ). For ( a ), ( c ), ( g ), and ( i ), data are shown as the mean ± s.e.m. of n=3 ( a ) or n=4 ( c , g , i ) independent experiments. For ( d ) and ( f ), scale bar is 20 µm. For ( e ) and ( h ), tubulin was used as a loading control and n.s. denotes a non-specific band. For source data, see .
Plko 1 Shtgfbr3 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shtgfbr3 puro/product/Addgene inc
Average 88 stars, based on 1 article reviews
plko 1 shtgfbr3 puro - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

93
Addgene inc plko 1 cre lentiviral vector
TGFBR3 and JUND are functionally important for 3D morphogenesis. ( a ) Time-dependent expression of TGFBR3 during 3D morphogenesis . ( b ) Knockdown of TGFBR3 and inducible addback of murine RNAi-resistant Tgfbr3. TGFBR3/Tgfbr3 levels for cells cultured in the absence (Lane 1 and 2) or presence (Lane 3) of 1 µg/ml DOX for 24 hours were analyzed by immunoblotting. Hsp90 was used as a loading control. Densitometry of TGFBR3/Tgfbr3 abundance is shown normalized to the shGFP control. ( c and d ) Blocking TGFBR3 induction specifically elicits a ductal-branching phenotype. The MCF10A-5E lines described in ( b ) were placed in morphogenesis in the absence (control and <t>shTGFBR3)</t> or presence (Tgfbr3 addback) of 1 µg/ml DOX from day 4–10. Acini were fixed at day 10 of 3D culture, stained for E-cadherin (green) and HA-tagged Tgfbr3 (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( e ) Constitutive expression of HA-tagged JUND analyzed by immunoblotting. Densitometry of JUND abundance is shown normalized to pBabe vector control. ( f and g ) Constitutive JUND expression causes stable cribiform-like acinar structures. Acini from the MCF10A-5E lines described in ( e ) were placed in morphogenesis, fixed at day 28, stained for E-cadherin (green) and HA-tagged JUND (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( h ) Homogenization of JUND expression by knockdown of JUND and addback with murine RNAi-resistant JunD to near-endogenous expression levels. JUND/JunD levels were determined by immunoblotting. Densitometry of JUND/JunD abundance is shown normalized to the shGFP control. ( i ) Quantification of the cribiform-like phenotype at day 28 of 3D culture for the cells in ( h ). For ( a ), ( c ), ( g ), and ( i ), data are shown as the mean ± s.e.m. of n=3 ( a ) or n=4 ( c , g , i ) independent experiments. For ( d ) and ( f ), scale bar is 20 µm. For ( e ) and ( h ), tubulin was used as a loading control and n.s. denotes a non-specific band. For source data, see .
Plko 1 Cre Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 cre lentiviral vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 cre lentiviral vector - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) pLKO.1 control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.

Journal: Journal of Virology

Article Title: Digitoxin Suppresses Human Cytomegalovirus Replication via Na + , K + /ATPase α1 Subunit-Dependent AMP-Activated Protein Kinase and Autophagy Activation

doi: 10.1128/JVI.01861-17

Figure Lengend Snippet: Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) pLKO.1 control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.

Article Snippet: The following sequences were used to generate Na + ,K + /ATPase α1 subunit short hairpin RNA (shRNA) and a nonsilencing (NS) control by cloning into the lentiviral vector pLKO.1 hygro (Addgene): clone 1, 5′-GCCTTTCAGAACGCCTATTG-3′; clone 2, 5′-ATACCTTAACCAGTAACATTC-3′, and NS, 5′-CCTAAGGTTAAGTCGCCCTCG-3′.

Techniques: Generated, shRNA, Infection, Expressing

Digitoxin fails to induce autophagy or to inhibit HCMV in α1 KD cells. (A) Control and α1 KD cells were infected and treated with digitoxin (30 nM), AICAR (0.8 μM), digitoxin plus AICAR, or GCV. Levels of pp65, pAMPK, and p62 were detected by WB at 72 hpi. (B) Uninfected cells were treated with digitoxin or GCV. Levels of pAMPK and p62 were detected by WB. (C) α1 KD and control HFFs were infected with HCMV Towne (100 plaques/well), followed by treatment with digitoxin or GCV. Plaques were counted under each condition at day 8 postinfection. (D) (Left) Lysates from panel A were used to detect mTOR, p-mTOR, and the mTOR substrates p-Ser S6K and p-Thr S6K. (Right) p-mTOR levels were quantitated by densitometry. (E) pLKO.1 and α1 KD cells were infected and treated with digitoxin or GCV for 12 h. One-milligram aliquots of protein from the prepared lysates were used to pull down ULK1. AMPK, mTOR, and α1 were detected by WB of the input samples.

Journal: Journal of Virology

Article Title: Digitoxin Suppresses Human Cytomegalovirus Replication via Na + , K + /ATPase α1 Subunit-Dependent AMP-Activated Protein Kinase and Autophagy Activation

doi: 10.1128/JVI.01861-17

Figure Lengend Snippet: Digitoxin fails to induce autophagy or to inhibit HCMV in α1 KD cells. (A) Control and α1 KD cells were infected and treated with digitoxin (30 nM), AICAR (0.8 μM), digitoxin plus AICAR, or GCV. Levels of pp65, pAMPK, and p62 were detected by WB at 72 hpi. (B) Uninfected cells were treated with digitoxin or GCV. Levels of pAMPK and p62 were detected by WB. (C) α1 KD and control HFFs were infected with HCMV Towne (100 plaques/well), followed by treatment with digitoxin or GCV. Plaques were counted under each condition at day 8 postinfection. (D) (Left) Lysates from panel A were used to detect mTOR, p-mTOR, and the mTOR substrates p-Ser S6K and p-Thr S6K. (Right) p-mTOR levels were quantitated by densitometry. (E) pLKO.1 and α1 KD cells were infected and treated with digitoxin or GCV for 12 h. One-milligram aliquots of protein from the prepared lysates were used to pull down ULK1. AMPK, mTOR, and α1 were detected by WB of the input samples.

Article Snippet: The following sequences were used to generate Na + ,K + /ATPase α1 subunit short hairpin RNA (shRNA) and a nonsilencing (NS) control by cloning into the lentiviral vector pLKO.1 hygro (Addgene): clone 1, 5′-GCCTTTCAGAACGCCTATTG-3′; clone 2, 5′-ATACCTTAACCAGTAACATTC-3′, and NS, 5′-CCTAAGGTTAAGTCGCCCTCG-3′.

Techniques: Infection

TGFBR3 and JUND are functionally important for 3D morphogenesis. ( a ) Time-dependent expression of TGFBR3 during 3D morphogenesis . ( b ) Knockdown of TGFBR3 and inducible addback of murine RNAi-resistant Tgfbr3. TGFBR3/Tgfbr3 levels for cells cultured in the absence (Lane 1 and 2) or presence (Lane 3) of 1 µg/ml DOX for 24 hours were analyzed by immunoblotting. Hsp90 was used as a loading control. Densitometry of TGFBR3/Tgfbr3 abundance is shown normalized to the shGFP control. ( c and d ) Blocking TGFBR3 induction specifically elicits a ductal-branching phenotype. The MCF10A-5E lines described in ( b ) were placed in morphogenesis in the absence (control and shTGFBR3) or presence (Tgfbr3 addback) of 1 µg/ml DOX from day 4–10. Acini were fixed at day 10 of 3D culture, stained for E-cadherin (green) and HA-tagged Tgfbr3 (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( e ) Constitutive expression of HA-tagged JUND analyzed by immunoblotting. Densitometry of JUND abundance is shown normalized to pBabe vector control. ( f and g ) Constitutive JUND expression causes stable cribiform-like acinar structures. Acini from the MCF10A-5E lines described in ( e ) were placed in morphogenesis, fixed at day 28, stained for E-cadherin (green) and HA-tagged JUND (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( h ) Homogenization of JUND expression by knockdown of JUND and addback with murine RNAi-resistant JunD to near-endogenous expression levels. JUND/JunD levels were determined by immunoblotting. Densitometry of JUND/JunD abundance is shown normalized to the shGFP control. ( i ) Quantification of the cribiform-like phenotype at day 28 of 3D culture for the cells in ( h ). For ( a ), ( c ), ( g ), and ( i ), data are shown as the mean ± s.e.m. of n=3 ( a ) or n=4 ( c , g , i ) independent experiments. For ( d ) and ( f ), scale bar is 20 µm. For ( e ) and ( h ), tubulin was used as a loading control and n.s. denotes a non-specific band. For source data, see .

Journal: Nature cell biology

Article Title: A time- and matrix-dependent TGFBR3–JUND–KRT5 regulatory circuit in single breast epithelial cells and basal-like premalignancies

doi: 10.1038/ncb2930

Figure Lengend Snippet: TGFBR3 and JUND are functionally important for 3D morphogenesis. ( a ) Time-dependent expression of TGFBR3 during 3D morphogenesis . ( b ) Knockdown of TGFBR3 and inducible addback of murine RNAi-resistant Tgfbr3. TGFBR3/Tgfbr3 levels for cells cultured in the absence (Lane 1 and 2) or presence (Lane 3) of 1 µg/ml DOX for 24 hours were analyzed by immunoblotting. Hsp90 was used as a loading control. Densitometry of TGFBR3/Tgfbr3 abundance is shown normalized to the shGFP control. ( c and d ) Blocking TGFBR3 induction specifically elicits a ductal-branching phenotype. The MCF10A-5E lines described in ( b ) were placed in morphogenesis in the absence (control and shTGFBR3) or presence (Tgfbr3 addback) of 1 µg/ml DOX from day 4–10. Acini were fixed at day 10 of 3D culture, stained for E-cadherin (green) and HA-tagged Tgfbr3 (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( e ) Constitutive expression of HA-tagged JUND analyzed by immunoblotting. Densitometry of JUND abundance is shown normalized to pBabe vector control. ( f and g ) Constitutive JUND expression causes stable cribiform-like acinar structures. Acini from the MCF10A-5E lines described in ( e ) were placed in morphogenesis, fixed at day 28, stained for E-cadherin (green) and HA-tagged JUND (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( h ) Homogenization of JUND expression by knockdown of JUND and addback with murine RNAi-resistant JunD to near-endogenous expression levels. JUND/JunD levels were determined by immunoblotting. Densitometry of JUND/JunD abundance is shown normalized to the shGFP control. ( i ) Quantification of the cribiform-like phenotype at day 28 of 3D culture for the cells in ( h ). For ( a ), ( c ), ( g ), and ( i ), data are shown as the mean ± s.e.m. of n=3 ( a ) or n=4 ( c , g , i ) independent experiments. For ( d ) and ( f ), scale bar is 20 µm. For ( e ) and ( h ), tubulin was used as a loading control and n.s. denotes a non-specific band. For source data, see .

Article Snippet: pLKO.1 shGFP puro (Addgene #12273), pLKO.1 shTGFBR3 puro (TRCN0000033430), and pLKO.1 shJUND puro (TRCN0000014974) were obtained from The RNAi Consortium or Addgene. pBabe JunD-HA neo, pBabe JUND-HA neo, pBabe RFP1-Smad2 neo, pBabe JunD-Venus puro, and pBabe RFP1-KRT5 hygro were constructed by PCR cloning from plasmid templates (Open Biosystems) into the retroviral vector pBabe neo, pBabe puro, or pBabe hygro.

Techniques: Expressing, Knockdown, Cell Culture, Western Blot, Control, Blocking Assay, Staining, Immunofluorescence, Plasmid Preparation, Homogenization